w10.0.27 | c9.0.90.06
PROD | u7.5.14
Header Image
 

 

print content
increase font
decrease font

rRT-PCR Primers & Probes for nCoV Coronavirus

Primers and probes recommended by the CDC & WHO

Eurofins Genomics can provide the primer and probe sequences recommended by the CDC and the WHO to researchers working on the coronavirus.

The sequences were publically provided by the CDC here and the WHO here. Researchers can order these primers and probes to create a panel in their lab, following the panel instructions from the CDC.

These materials are provided for research purposes only.

 
CDC Approved Sequences*

Name Description Sequence (5' -> 3') Label

Working Conc.

2019-nCoV_N1-F

2019-nCoV_N1
Forward Primer

GAC CCC AAA ATC AGC GAA AT - 20 µM
2019-nCoV_N1-R

2019-nCoV_N1 
Reverse Primer

TCT GGT TAC TGC CAG TTG AAT CTG - 20 µM
2019-nCoV_N1-P

2019-nCoV_N1
Probe

FAM-ACC CCG CAT TAC GTT TGG TGG ACC-BHQ1 FAM,
BHQ-1
5 µM
2019-nCoV_N2-F

2019-nCoV_N2
Forward Primer

TTA CAA ACA TTG GCC GCA AA - 20 µM
2019-nCoV_N2-R

2019-nCoV_N2
Reverse Primer

GCG CGA CAT TCC GAA GAA - 20 µM
2019-nCoV_N2-P

2019-nCoV_N2
Probe

FAM-ACA ATT TGC CCC CAG CGC TTC AG-BHQ1 FAM,
BHQ-1
5 µM
2019-nCoV_N3-F

2019-nCoV_N3
Forward Primer

GGG AGC CTT GAA TAC ACC AAA A - 20 µM
2019-nCoV_N3-R

2019-nCoV_N3
Reverse Primer

TGT AGC ACG ATT GCA GCA TTG - 20 µM
2019-nCoV_N3-P

2019-nCoV_N3 Probe

FAM-AYC ACA TTG GCA CCC GCA ATC CTG-BHQ1 FAM,
BHQ-1
5 µM
RP-F

RNAse P 
Forward Primer

AGA TTT GGA CCT GCG AGC G - 20 µM
RP-R

RNAse P 
Reverse Primer

GAG CGG CTG TCT CCA CAA GT - 20 µM
RP-P

RNAse 
Probe

FAM – TTC TGA CCT GAA GGC TCT GCG CG – BHQ-1 FAM,
BHQ-1
5 µM

 

>> Order Now



WHO Approved Sequences

Assay

Name Sequence (5' -> 3')

Comment

 
RdRP
gene
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction  
 
RdRP_SARSr-R1

CARATGTTAAASACACTATTAGCATA
use 800 nM per reaction
  RdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV,
will not detect SARS-CoVuse
100 nM per reaction
and mix with P1
  RdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe,
will detect 2019-nCoV, SARS-CoV
and bat-SARS-related CoVsuse
100 nM per reaction and mix with P2
       
E gene E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT Use 400 nM per reaction
  E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA Use 400 nM per reaction
  E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nM per reaction

 

Ordering

We recommend to use the qPCR Assay order page to order the optimised and validated primer and probe sequences.

To order all recommended RdRP gene primers and probes, please use our Dual Labelled Probe and qPCR Primer order page. 



Publications

  1. (2020) 2019 Novel Coronavirus (2019-nCoV), Wuhan, China. [Online] US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  2. (2020) 2019-Novel coronavirus (2019-nCoV) real-time rRT-PCR panel primers and probes. US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  3. (2020) Real-time RT-PCR panel for detection 2019-novel coronavirus. US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  4. (2020) Emergency use authorization. [Online] US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].


Note

In order to prevent any cross-contamination of primers and probes with control plasmids, our standard procedure is to spatially separated our production of oligos and genes/plasmisds by separate rooms and  air systems!

 

*Eurofins Genomics does not claim that these materials are in any way endorsed or validated by the CDC.

Scroll to top ^^